rs201786064
From SNPedia
| Merged into | rs111200466 |
| Orientation | minus |
| Make rs201786064(-;-) |
| Make rs201786064(-;AGAGAACGCCGAGCAGCCGCCTG) |
| Make rs201786064(AGAGAACGCCGAGCAGCCGCCTG;AGAGAACGCCGAGCAGCCGCCTG) |
| Reference | GRCh38.p2 38.2/146 |
| Chromosome | 4 |
| Position | 153684312 |
| Gene | TLR2 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs201786064 |
| dbSNP (classic) | rs201786064 |
| ClinGen | rs201786064 |
| ebi | rs201786064 |
| HLI | rs201786064 |
| Exac | rs201786064 |
| Gnomad | rs201786064 |
| Varsome | rs201786064 |
| LitVar | rs201786064 |
| Map | rs201786064 |
| PheGenI | rs201786064 |
| Biobank | rs201786064 |
| 1000 genomes | rs201786064 |
| hgdp | rs201786064 |
| ensembl | rs201786064 |
| geneview | rs201786064 |
| scholar | rs201786064 |
| rs201786064 | |
| pharmgkb | rs201786064 |
| gwascentral | rs201786064 |
| openSNP | rs201786064 |
| 23andMe | rs201786064 |
| SNPshot | rs201786064 |
| SNPdbe | rs201786064 |
| MSV3d | rs201786064 |
| GWAS Ctlg | rs201786064 |
| Status | Merged into rs111200466 |
| Max Magnitude | 0 |
[PMID 26919710] Variations in genes involved in regulation of the nuclear factor - κB pathway and the risk of acute myeloid leukaemia.
