rs118192169
From SNPedia
Orientation | plus |
Stabilized | plus |
Geno | Mag | Summary |
---|---|---|
(-;TTCTACAACAAGAGCGAGGAT) | 4 | likely severe central core disease |
(TTCTACAACAAGAGCGAGGAT;TTCTACAACAAGAGCGAGGAT) | 0 | common in clinvar |
Make rs118192169(-;-) |
Reference | GRCh38 38.1/141 |
Chromosome | 19 |
Position | 38580445 |
Gene | RYR1 |
is a | snp |
is | mentioned by |
dbSNP | rs118192169 |
dbSNP (classic) | rs118192169 |
ClinGen | rs118192169 |
ebi | rs118192169 |
HLI | rs118192169 |
Exac | rs118192169 |
Gnomad | rs118192169 |
Varsome | rs118192169 |
LitVar | rs118192169 |
Map | rs118192169 |
PheGenI | rs118192169 |
Biobank | rs118192169 |
1000 genomes | rs118192169 |
hgdp | rs118192169 |
ensembl | rs118192169 |
geneview | rs118192169 |
scholar | rs118192169 |
rs118192169 | |
pharmgkb | rs118192169 |
gwascentral | rs118192169 |
openSNP | rs118192169 |
23andMe | rs118192169 |
SNPshot | rs118192169 |
SNPdbe | rs118192169 |
MSV3d | rs118192169 |
GWAS Ctlg | rs118192169 |
Max Magnitude | 4 |
ClinVar | |
---|---|
Risk | rs118192169(-;-) |
Alt | rs118192169(-;-) |
Reference | Rs118192169(TTCTACAACAAGAGCGAGGAT;TTCTACAACAAGAGCGAGGAT) |
Significance | Pathogenic |
Disease | Central core disease |
Variation | info |
Gene | RYR1 |
CLNDBN | Central core disease |
Reversed | 0 |
HGVS | NC_000019.9:g.39071085_39071105del21 |
CLNSRC | OMIM Allelic Variant |
CLNACC | RCV000013858.24, |
[PMID 12566385] Clinical and functional effects of a deletion in a COOH-terminal lumenal loop of the skeletal muscle ryanodine receptor.