rs118192169
From SNPedia
| Orientation | plus |
| Stabilized | plus |
| Geno | Mag | Summary |
|---|---|---|
| (-;TTCTACAACAAGAGCGAGGAT) | 4 | likely severe central core disease |
| (TTCTACAACAAGAGCGAGGAT;TTCTACAACAAGAGCGAGGAT) | 0 | common in clinvar |
| Make rs118192169(-;-) |
| Reference | GRCh38 38.1/141 |
| Chromosome | 19 |
| Position | 38580445 |
| Gene | RYR1 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs118192169 |
| dbSNP (classic) | rs118192169 |
| ClinGen | rs118192169 |
| ebi | rs118192169 |
| HLI | rs118192169 |
| Exac | rs118192169 |
| Gnomad | rs118192169 |
| Varsome | rs118192169 |
| LitVar | rs118192169 |
| Map | rs118192169 |
| PheGenI | rs118192169 |
| Biobank | rs118192169 |
| 1000 genomes | rs118192169 |
| hgdp | rs118192169 |
| ensembl | rs118192169 |
| geneview | rs118192169 |
| scholar | rs118192169 |
| rs118192169 | |
| pharmgkb | rs118192169 |
| gwascentral | rs118192169 |
| openSNP | rs118192169 |
| 23andMe | rs118192169 |
| SNPshot | rs118192169 |
| SNPdbe | rs118192169 |
| MSV3d | rs118192169 |
| GWAS Ctlg | rs118192169 |
| Max Magnitude | 4 |
| ClinVar | |
|---|---|
| Risk | rs118192169(-;-) |
| Alt | rs118192169(-;-) |
| Reference | Rs118192169(TTCTACAACAAGAGCGAGGAT;TTCTACAACAAGAGCGAGGAT) |
| Significance | Pathogenic |
| Disease | Central core disease |
| Variation | info |
| Gene | RYR1 |
| CLNDBN | Central core disease |
| Reversed | 0 |
| HGVS | NC_000019.9:g.39071085_39071105del21 |
| CLNSRC | OMIM Allelic Variant |
| CLNACC | RCV000013858.24, |
[PMID 12566385] Clinical and functional effects of a deletion in a COOH-terminal lumenal loop of the skeletal muscle ryanodine receptor.
