rs333
| HIV Resistance |
| Orientation | plus |
| Stabilized | plus |
| Geno | Mag | Summary |
|---|---|---|
| (-;-) | 4 | very resistant to HIV |
| (-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) | 2 | resistant to HIV |
| (GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) | 0 | common form |
| Reference | GRCh38 38.1/141 |
| Chromosome | 3 |
| Position | 46373456 |
| Gene | CCR5, LOC102724297 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs333 |
| dbSNP (classic) | rs333 |
| ClinGen | rs333 |
| ebi | rs333 |
| HLI | rs333 |
| Exac | rs333 |
| Gnomad | rs333 |
| Varsome | rs333 |
| LitVar | rs333 |
| Map | rs333 |
| PheGenI | rs333 |
| Biobank | rs333 |
| 1000 genomes | rs333 |
| hgdp | rs333 |
| ensembl | rs333 |
| geneview | rs333 |
| scholar | rs333 |
| rs333 | |
| pharmgkb | rs333 |
| gwascentral | rs333 |
| openSNP | rs333 |
| 23andMe | rs333 |
| SNPshot | rs333 |
| SNPdbe | rs333 |
| MSV3d | rs333 |
| GWAS Ctlg | rs333 |
| Max Magnitude | 4 |
The chemokine receptor gene CCR5 plays an important role in many immune-related processes. Delta 32 rs333, designating the CCR5-delta32 deletion of 32 nucleotides from within the gene, is perhaps the most famous allele of CCR5. 23andMe tests for this under their private identifier/name, I3003626.
Individuals carrying one copy of the delta 32 allele are somewhat resistant to infection by HIV, the virus that causes AIDS, and individuals with 2 copies (delta 32 homozygotes, ~1% of Caucasians) are almost completely immune to infection by HIV. [PMID 8898752] The delta 32 allele may have been selected for in European populations because it confers resistance to plague (Black Death) or smallpox. [1]
[PMID 16216086
] shows the the geographic spread of the allele. [[Image:Journal.pbio.0030339.g001.png|thumb|300px|The geographic spread of the allele [PMID 16216086]]]
NEJM suggests decreased risk of type 1 diabetes (odds ratio, 0.54; 95% CI, 0.40 to 0.72; P=1.88x10–6 with 2 df).
Does the CCR5-delta32 mutation have an entirely positive/protective role?
Probably not. In patients with abdominal aortic aneurysm (AAA), the major risk is a sudden rupture - which is quite often fatal. Individuals with the delta 32 variant are more likely to have aneurysms than non-carriers, and among patients with aneurysms, delta 32 carriers are more likely to rupture than to be diagnosed in time for surgical repair. [PMID 15557916]
Tests for CCR-delta32 are offered by FamilyTreeDNA (FAQ), 23andMe, and possibly other direct-to-consumer genetics testing companies.
[PMID 15726497] Gene-environment interaction effects on the development of immune responses in the 1st year of life.
[PMID 17327408] Prognostic significance of host immune gene polymorphisms in follicular lymphoma survival.
[PMID 17355643] Frequencies of single nucleotide polymorphisms in genes regulating inflammatory responses in a community-based population.
[PMID 17672867] Polymorphisms in chemokine receptor genes and susceptibility to Kawasaki disease.
[PMID 18633131] Host immune gene polymorphisms in combination with clinical and demographic factors predict late survival in diffuse large B-cell lymphoma patients in the pre-rituximab era.
[PMID 18805939] Functional genetic polymorphisms and female reproductive disorders: part II--endometriosis.
[PMID 19066394] Organochlorine exposure, immune gene variation, and risk of non-Hodgkin lymphoma.
[PMID 19073967] Shared and distinct genetic variants in type 1 diabetes and celiac disease.
[PMID 19131662] A meta-analysis of candidate gene polymorphisms and ischemic stroke in 6 study populations: association of lymphotoxin-alpha in nonhypertensive patients.
[PMID 19225544] Variation in the lymphotoxin-alpha/tumor necrosis factor locus modifies risk of erythema nodosum in sarcoidosis.
[PMID 19263529] Genetic risk factors in recurrent venous thromboembolism: A multilocus, population-based, prospective approach.
[PMID 19330901] Association of 77 polymorphisms in 52 candidate genes with blood pressure progression and incident hypertension: the Women's Genome Health Study.
[PMID 19559392] A candidate gene association study of 77 polymorphisms in migraine.
[PMID 20041166] Common genetic variation and the control of HIV-1 in humans.
[PMID 20206716] Genetic variation within the gene encoding the HIV-1 CCR5 coreceptor in two South African populations.
[PMID 20552027] Host and viral genetic correlates of clinical definitions of HIV-1 disease progression.
[PMID 21854194] Distribution of polymorphisms in cytochrome P450 2B6, histocompatibility complex P5, chemokine coreceptor 5, and interleukin 28B genes in inhabitants from the central area of Argentina.
[PMID 22474614] Host Genes Important to HIV Replication and Evolution.
[PMID 23632061] CCR2 and CCR5 genes polymorphisms in benign prostatic hyperplasia and prostate cancer [PMID 23107763] Host genetic risk factors for community-acquired pneumonia.
| ClinVar | |
|---|---|
| Risk | Rs333(-;-) rs333(ACAGTCAGTATCAATTCTGGAAGAATTTCCAG;ACAGTCAGTATCAATTCTGGAAGAATTTCCAG) |
| Alt | Rs333(-;-) rs333(ACAGTCAGTATCAATTCTGGAAGAATTTCCAG;ACAGTCAGTATCAATTCTGGAAGAATTTCCAG) |
| Reference | Rs333(GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) |
| Significance | Other |
| Disease | Human immunodeficiency virus type 1 West nile virus Resistance to hepatitis C virus Multiple sclerosis modifier of disease progression |
| Variation | info |
| Gene | LOC102724297 CCR5 |
| CLNDBN | Human immunodeficiency virus type 1, susceptibility to West nile virus, susceptibility to Resistance to hepatitis C virus Multiple sclerosis modifier of disease progression |
| Reversed | 0 |
| HGVS | NC_000003.11:g.46414947_46414978del32 |
| CLNSRC | OMIM Allelic Variant |
| CLNACC | RCV000008663.4, RCV000008664.3, RCV000008665.5, RCV000008666.4, |
[PMID 26071874] CCR5Δ32 (rs333) polymorphism is associated with the susceptibility to systemic lupus erythematosus in female Brazilian patients
[PMID 31148855] Evaluation of HCP5 and Chemokine C Receptor type 5 Gene Polymorphisms in Indian Psoriatic Patients.
