rs3730485
From SNPedia
Orientation | plus |
Stabilized | plus |
Make rs3730485(-;-) |
Make rs3730485(-;AAAAAGCTGCAGAAGGGAAGGATATAACTTTATAAAAAAA) |
Make rs3730485(AAAAAGCTGCAGAAGGGAAGGATATAACTTTATAAAAAAA;AAAAAGCTGCAGAAGGGAAGGATATAACTTTATAAAAAAA) |
Reference | GRCh38 38.1/141 |
Chromosome | 12 |
Position | 68807065 |
Gene | LOC100130075, MDM2 |
is a | snp |
is | mentioned by |
dbSNP | rs3730485 |
dbSNP (classic) | rs3730485 |
ClinGen | rs3730485 |
ebi | rs3730485 |
HLI | rs3730485 |
Exac | rs3730485 |
Gnomad | rs3730485 |
Varsome | rs3730485 |
LitVar | rs3730485 |
Map | rs3730485 |
PheGenI | rs3730485 |
Biobank | rs3730485 |
1000 genomes | rs3730485 |
hgdp | rs3730485 |
ensembl | rs3730485 |
geneview | rs3730485 |
scholar | rs3730485 |
rs3730485 | |
pharmgkb | rs3730485 |
gwascentral | rs3730485 |
openSNP | rs3730485 |
23andMe | rs3730485 |
SNPshot | rs3730485 |
SNPdbe | rs3730485 |
MSV3d | rs3730485 |
GWAS Ctlg | rs3730485 |
Max Magnitude | 0 |
[PMID 22285926] A 40-bp insertion/deletion polymorphism in the constitutive promoter of MDM2 confers risk for hepatocellular carcinoma in a Chinese population
[PMID 20617153] Detection of fetomaternal genotype associations in early-onset disorders: evaluation of different methods and their application to childhood leukemia.
[PMID 27785069] Influence of MDM2 polymorphisms on squamous cell carcinoma susceptibility: a meta-analysis.