rs3730485
From SNPedia
| Orientation | plus |
| Stabilized | plus |
| Make rs3730485(-;-) |
| Make rs3730485(-;AAAAAGCTGCAGAAGGGAAGGATATAACTTTATAAAAAAA) |
| Make rs3730485(AAAAAGCTGCAGAAGGGAAGGATATAACTTTATAAAAAAA;AAAAAGCTGCAGAAGGGAAGGATATAACTTTATAAAAAAA) |
| Reference | GRCh38 38.1/141 |
| Chromosome | 12 |
| Position | 68807065 |
| Gene | LOC100130075, MDM2 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs3730485 |
| dbSNP (classic) | rs3730485 |
| ClinGen | rs3730485 |
| ebi | rs3730485 |
| HLI | rs3730485 |
| Exac | rs3730485 |
| Gnomad | rs3730485 |
| Varsome | rs3730485 |
| LitVar | rs3730485 |
| Map | rs3730485 |
| PheGenI | rs3730485 |
| Biobank | rs3730485 |
| 1000 genomes | rs3730485 |
| hgdp | rs3730485 |
| ensembl | rs3730485 |
| geneview | rs3730485 |
| scholar | rs3730485 |
| rs3730485 | |
| pharmgkb | rs3730485 |
| gwascentral | rs3730485 |
| openSNP | rs3730485 |
| 23andMe | rs3730485 |
| SNPshot | rs3730485 |
| SNPdbe | rs3730485 |
| MSV3d | rs3730485 |
| GWAS Ctlg | rs3730485 |
| Max Magnitude | 0 |
[PMID 22285926] A 40-bp insertion/deletion polymorphism in the constitutive promoter of MDM2 confers risk for hepatocellular carcinoma in a Chinese population
[PMID 20617153
] Detection of fetomaternal genotype associations in early-onset disorders: evaluation of different methods and their application to childhood leukemia.
[PMID 27785069] Influence of MDM2 polymorphisms on squamous cell carcinoma susceptibility: a meta-analysis.
