rs3836790
From SNPedia
| Orientation | minus |
| Stabilized | minus |
| Geno | Mag | Summary |
|---|---|---|
| (-;-) | 0 | common in complete genomics |
| Make rs3836790(-;TGTCTGAGTGTGTATGTTGCATGGTATGTG) |
| Make rs3836790(TGTCTGAGTGTGTATGTTGCATGGTATGTG;TGTCTGAGTGTGTATGTTGCATGGTATGTG) |
| Reference | GRCh38 38.1/141 |
| Chromosome | 5 |
| Position | 1411740 |
| Gene | SLC6A3 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs3836790 |
| dbSNP (classic) | rs3836790 |
| ClinGen | rs3836790 |
| ebi | rs3836790 |
| HLI | rs3836790 |
| Exac | rs3836790 |
| Gnomad | rs3836790 |
| Varsome | rs3836790 |
| LitVar | rs3836790 |
| Map | rs3836790 |
| PheGenI | rs3836790 |
| Biobank | rs3836790 |
| 1000 genomes | rs3836790 |
| hgdp | rs3836790 |
| ensembl | rs3836790 |
| geneview | rs3836790 |
| scholar | rs3836790 |
| rs3836790 | |
| pharmgkb | rs3836790 |
| gwascentral | rs3836790 |
| openSNP | rs3836790 |
| 23andMe | rs3836790 |
| SNPshot | rs3836790 |
| SNPdbe | rs3836790 |
| MSV3d | rs3836790 |
| GWAS Ctlg | rs3836790 |
| Max Magnitude | 0 |
[PMID 21525861
] Dopamine Transporter Gene Variant Affecting Expression in Human Brain is Associated with Bipolar Disorder
[PMID 23340505
] Dopamine transporter DAT and receptor DRD2 variants affect risk of lethal cocaine abuse: a gene-gene-environment interaction
[PMID 25805645
] Polymorphism of the dopamine transporter type 1 gene modifies the treatment response in Parkinson's disease
[PMID 25850966
] Genetic variation of the dopamine transporter (DAT1) influences the acute subjective responses to cocaine in volunteers with cocaine use disorders
