rs3842570
| Orientation | plus |
| Stabilized | plus |
| Make rs3842570(-;-) |
| Make rs3842570(-;C) |
| Make rs3842570(C;C) |
| Reference | GRCh38 38.1/141 |
| Chromosome | 2 |
| Position | 240594876 |
| Gene | CAPN10 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs3842570 |
| dbSNP (classic) | rs3842570 |
| ClinGen | rs3842570 |
| ebi | rs3842570 |
| HLI | rs3842570 |
| Exac | rs3842570 |
| Gnomad | rs3842570 |
| Varsome | rs3842570 |
| LitVar | rs3842570 |
| Map | rs3842570 |
| PheGenI | rs3842570 |
| Biobank | rs3842570 |
| 1000 genomes | rs3842570 |
| hgdp | rs3842570 |
| ensembl | rs3842570 |
| geneview | rs3842570 |
| scholar | rs3842570 |
| rs3842570 | |
| pharmgkb | rs3842570 |
| gwascentral | rs3842570 |
| openSNP | rs3842570 |
| 23andMe | rs3842570 |
| SNPshot | rs3842570 |
| SNPdbe | rs3842570 |
| MSV3d | rs3842570 |
| GWAS Ctlg | rs3842570 |
| Max Magnitude | 0 |
[PMID 19752882] Association of calpain-10 gene polymorphism and posttransplant diabetes mellitus in kidney transplant patients medicated with tacrolimus
[PMID 20470430
] Common polymorphisms of calpain-10 and the risk of Type 2 Diabetes in a Tunisian Arab population: a case-control study
[PMID 14730479
] Are variants in the CAPN10 gene related to risk of type 2 diabetes? A quantitative assessment of population and family-based association studies.
[PMID 19387820
] Genetic polymorphisms of FSHR, CYP17, CYP1A1, CAPN10, INSR, SERPINE1 genes in adolescent girls with polycystic ovary syndrome.
[PMID 20667559] Association of calpain 10 gene polymorphisms with type 2 diabetes mellitus in Southern Indians.
| ClinVar | |
|---|---|
| Risk | rs3842570(GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT;GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT) |
| Alt | rs3842570(GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT;GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT) |
| Reference | rs3842570(-;-) |
| Significance | Other |
| Disease | Diabetes mellitus type 2 |
| Variation | info |
| Gene | CAPN10 |
| CLNDBN | Diabetes mellitus type 2 |
| Reversed | 0 |
| HGVS | NC_000002.11:g.241534262_241534293dup32 |
| CLNSRC | OMIM Allelic Variant |
| CLNACC | RCV000005399.3, |
