rs3842570
| Orientation | plus | 
| Stabilized | plus | 
| Make rs3842570(-;-) | 
| Make rs3842570(-;C) | 
| Make rs3842570(C;C) | 
| Reference | GRCh38 38.1/141 | 
| Chromosome | 2 | 
| Position | 240594876 | 
| Gene | CAPN10 | 
| is a | snp | 
| is | mentioned by | 
| dbSNP | rs3842570 | 
| dbSNP (classic) | rs3842570 | 
| ClinGen | rs3842570 | 
| ebi | rs3842570 | 
| HLI | rs3842570 | 
| Exac | rs3842570 | 
| Gnomad | rs3842570 | 
| Varsome | rs3842570 | 
| LitVar | rs3842570 | 
| Map | rs3842570 | 
| PheGenI | rs3842570 | 
| Biobank | rs3842570 | 
| 1000 genomes | rs3842570 | 
| hgdp | rs3842570 | 
| ensembl | rs3842570 | 
| geneview | rs3842570 | 
| scholar | rs3842570 | 
| rs3842570 | |
| pharmgkb | rs3842570 | 
| gwascentral | rs3842570 | 
| openSNP | rs3842570 | 
| 23andMe | rs3842570 | 
| SNPshot | rs3842570 | 
| SNPdbe | rs3842570 | 
| MSV3d | rs3842570 | 
| GWAS Ctlg | rs3842570 | 
| Max Magnitude | 0 | 
[PMID 19752882] Association of calpain-10 gene polymorphism and posttransplant diabetes mellitus in kidney transplant patients medicated with tacrolimus
[PMID 20470430
] Common polymorphisms of calpain-10 and the risk of Type 2 Diabetes in a Tunisian Arab population: a case-control study
[PMID 14730479
] Are variants in the CAPN10 gene related to risk of type 2 diabetes? A quantitative assessment of population and family-based association studies.
[PMID 19387820
] Genetic polymorphisms of FSHR, CYP17, CYP1A1, CAPN10, INSR, SERPINE1 genes in adolescent girls with polycystic ovary syndrome.
[PMID 20667559] Association of calpain 10 gene polymorphisms with type 2 diabetes mellitus in Southern Indians.
| ClinVar | |
|---|---|
| Risk | rs3842570(GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT;GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT) | 
| Alt | rs3842570(GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT;GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT) | 
| Reference | rs3842570(-;-) | 
| Significance | Other | 
| Disease | Diabetes mellitus type 2 | 
| Variation | info | 
| Gene | CAPN10 | 
| CLNDBN | Diabetes mellitus type 2 | 
| Reversed | 0 | 
| HGVS | NC_000002.11:g.241534262_241534293dup32 | 
| CLNSRC | OMIM Allelic Variant | 
| CLNACC | RCV000005399.3, | 
