rs398123112
From SNPedia
| Orientation | plus |
| Stabilized | plus |
| Geno | Mag | Summary |
|---|---|---|
| (-;-) | 7.7 | X-linked adrenoleukodystrophy; symptoms and age of onset highly variable |
| (-;GGTGGCCCACGCCTACCGCCTCT) | 4.4 | Carrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possible |
| (GGTGGCCCACGCCTACCGCCTCT;GGTGGCCCACGCCTACCGCCTCT) | 0 | common in clinvar |
| (TCTGGTGGCCCACGCCTACCGCC;TCTGGTGGCCCACGCCTACCGCC) | 0 | common in clinvar |
| Reference | GRCh38 38.1/141 |
| Chromosome | X |
| Position | 153725764 |
| Gene | ABCD1, BCAP31 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs398123112 |
| dbSNP (classic) | rs398123112 |
| ClinGen | rs398123112 |
| ebi | rs398123112 |
| HLI | rs398123112 |
| Exac | rs398123112 |
| Gnomad | rs398123112 |
| Varsome | rs398123112 |
| LitVar | rs398123112 |
| Map | rs398123112 |
| PheGenI | rs398123112 |
| Biobank | rs398123112 |
| 1000 genomes | rs398123112 |
| hgdp | rs398123112 |
| ensembl | rs398123112 |
| geneview | rs398123112 |
| scholar | rs398123112 |
| rs398123112 | |
| pharmgkb | rs398123112 |
| gwascentral | rs398123112 |
| openSNP | rs398123112 |
| 23andMe | rs398123112 |
| SNPshot | rs398123112 |
| SNPdbe | rs398123112 |
| MSV3d | rs398123112 |
| GWAS Ctlg | rs398123112 |
| Max Magnitude | 7.7 |
c.498_520del23 (p.Val167Leufs)
| ClinVar | |
|---|---|
| Risk | Rs398123112(-;-) |
| Alt | Rs398123112(-;-) |
| Reference | Rs398123112(TCTGGTGGCCCACGCCTACCGCC;TCTGGTGGCCCACGCCTACCGCC) |
| Significance | Pathogenic |
| Disease | Adrenoleukodystrophy |
| Variation | info |
| Gene | BCAP31 ABCD1 |
| CLNDBN | Adrenoleukodystrophy |
| Reversed | 0 |
| HGVS | NC_000023.10:g.152991219_152991241del23 |
| CLNSRC | ClinVar |
| CLNACC | RCV000077966.4, |
