rs80356802
From SNPedia
| Orientation | minus |
| Stabilized | minus |
| Make rs80356802(-;-) |
| Make rs80356802(-;GTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG) |
| Reference | GRCh38 38.1/141 |
| Chromosome | 11 |
| Position | 68775232 |
| Gene | CPT1A |
| is a | snp |
| is | mentioned by |
| dbSNP | rs80356802 |
| dbSNP (classic) | rs80356802 |
| ClinGen | rs80356802 |
| ebi | rs80356802 |
| HLI | rs80356802 |
| Exac | rs80356802 |
| Gnomad | rs80356802 |
| Varsome | rs80356802 |
| LitVar | rs80356802 |
| Map | rs80356802 |
| PheGenI | rs80356802 |
| Biobank | rs80356802 |
| 1000 genomes | rs80356802 |
| hgdp | rs80356802 |
| ensembl | rs80356802 |
| geneview | rs80356802 |
| scholar | rs80356802 |
| rs80356802 | |
| pharmgkb | rs80356802 |
| gwascentral | rs80356802 |
| openSNP | rs80356802 |
| 23andMe | rs80356802 |
| SNPshot | rs80356802 |
| SNPdbe | rs80356802 |
| MSV3d | rs80356802 |
| GWAS Ctlg | rs80356802 |
| Max Magnitude | 0 |
| ClinVar | |
|---|---|
| Risk | |
| Alt | |
| Reference | Rs80356802(GTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG;GTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG) |
| Significance | Pathogenic |
| Disease | Carnitine palmitoyltransferase I deficiency |
| Variation | info |
| Gene | CPT1A |
| CLNDBN | Carnitine palmitoyltransferase I deficiency |
| Reversed | 1 |
| HGVS | NC_000011.9:g.68542700_68542783del84 |
| CLNSRC | GeneReviews |
| CLNACC | RCV000034299.2, |
[PMID 12189492] Organization of the human liver carnitine palmitoyltransferase 1 gene ( CPT1A) and identification of novel mutations in hypoketotic hypoglycaemia.
