rs80359874
From SNPedia
| Orientation | minus |
| Stabilized | minus |
| Geno | Mag | Summary |
|---|---|---|
| (-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) | 6 | BRCA1 variant considered pathogenic for breast cancer |
| (TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) | 0 | Normal |
| Make rs80359874(-;-) |
| Reference | GRCh38 38.1/141 |
| Chromosome | 17 |
| Position | 43094317 |
| Gene | BRCA1 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs80359874 |
| dbSNP (classic) | rs80359874 |
| ClinGen | rs80359874 |
| ebi | rs80359874 |
| HLI | rs80359874 |
| Exac | rs80359874 |
| Gnomad | rs80359874 |
| Varsome | rs80359874 |
| LitVar | rs80359874 |
| Map | rs80359874 |
| PheGenI | rs80359874 |
| Biobank | rs80359874 |
| 1000 genomes | rs80359874 |
| hgdp | rs80359874 |
| ensembl | rs80359874 |
| geneview | rs80359874 |
| scholar | rs80359874 |
| rs80359874 | |
| pharmgkb | rs80359874 |
| gwascentral | rs80359874 |
| openSNP | rs80359874 |
| 23andMe | rs80359874 |
| SNPshot | rs80359874 |
| SNPdbe | rs80359874 |
| MSV3d | rs80359874 |
| GWAS Ctlg | rs80359874 |
| Max Magnitude | 6 |
rs80359874, also known as 1294del40, c.1175_1214del and p.Leu392_Ser405?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
| ClinVar | |
|---|---|
| Risk | rs80359874(-;-) |
| Alt | rs80359874(-;-) |
| Reference | Rs80359874(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) |
| Significance | Pathogenic |
| Disease | Breast-ovarian cancer Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified |
| Variation | info |
| Gene | BRCA1 |
| CLNDBN | Breast-ovarian cancer, familial 1 Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified |
| Reversed | 1 |
| HGVS | NC_000017.10:g.41246334_41246373del40 |
| CLNSRC | Breast Cancer Information Core (BRCA1) OMIM Allelic Variant |
| CLNACC | RCV000019234.15, RCV000047372.6, RCV000131965.3, RCV000159899.3, RCV000238898.1, |
