rs80359874
From SNPedia
					| Orientation | minus | 
| Stabilized | minus | 
| Geno | Mag | Summary | 
|---|---|---|
| (-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) | 6 | BRCA1 variant considered pathogenic for breast cancer | 
| (TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) | 0 | Normal | 
| Make rs80359874(-;-) | 
| Reference | GRCh38 38.1/141 | 
| Chromosome | 17 | 
| Position | 43094317 | 
| Gene | BRCA1 | 
| is a | snp | 
| is | mentioned by | 
| dbSNP | rs80359874 | 
| dbSNP (classic) | rs80359874 | 
| ClinGen | rs80359874 | 
| ebi | rs80359874 | 
| HLI | rs80359874 | 
| Exac | rs80359874 | 
| Gnomad | rs80359874 | 
| Varsome | rs80359874 | 
| LitVar | rs80359874 | 
| Map | rs80359874 | 
| PheGenI | rs80359874 | 
| Biobank | rs80359874 | 
| 1000 genomes | rs80359874 | 
| hgdp | rs80359874 | 
| ensembl | rs80359874 | 
| geneview | rs80359874 | 
| scholar | rs80359874 | 
| rs80359874 | |
| pharmgkb | rs80359874 | 
| gwascentral | rs80359874 | 
| openSNP | rs80359874 | 
| 23andMe | rs80359874 | 
| SNPshot | rs80359874 | 
| SNPdbe | rs80359874 | 
| MSV3d | rs80359874 | 
| GWAS Ctlg | rs80359874 | 
| Max Magnitude | 6 | 
rs80359874, also known as 1294del40, c.1175_1214del and p.Leu392_Ser405?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
| ClinVar | |
|---|---|
| Risk | rs80359874(-;-) | 
| Alt | rs80359874(-;-) | 
| Reference | Rs80359874(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) | 
| Significance | Pathogenic | 
| Disease | Breast-ovarian cancer Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified | 
| Variation | info | 
| Gene | BRCA1 | 
| CLNDBN | Breast-ovarian cancer, familial 1 Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified | 
| Reversed | 1 | 
| HGVS | NC_000017.10:g.41246334_41246373del40 | 
| CLNSRC | Breast Cancer Information Core (BRCA1) OMIM Allelic Variant | 
| CLNACC | RCV000019234.15, RCV000047372.6, RCV000131965.3, RCV000159899.3, RCV000238898.1, | 


