rs61276843
From SNPedia
| Orientation | plus |
| Stabilized | plus |
| Make rs61276843(-;-) |
| Make rs61276843(-;GAGAGAGGCGGCGCCCCGGGG) |
| Make rs61276843(GAGAGAGGCGGCGCCCCGGGG;GAGAGAGGCGGCGCCCCGGGG) |
| Reference | GRCh37.p10 37.5/138 |
| Chromosome | 22 |
| Position | 26880005 |
| Gene | HPS4, SRRD |
| is a | snp |
| is | mentioned by |
| dbSNP | rs61276843 |
| dbSNP (classic) | rs61276843 |
| ClinGen | rs61276843 |
| ebi | rs61276843 |
| HLI | rs61276843 |
| Exac | rs61276843 |
| Gnomad | rs61276843 |
| Varsome | rs61276843 |
| LitVar | rs61276843 |
| Map | rs61276843 |
| PheGenI | rs61276843 |
| Biobank | rs61276843 |
| 1000 genomes | rs61276843 |
| hgdp | rs61276843 |
| ensembl | rs61276843 |
| geneview | rs61276843 |
| scholar | rs61276843 |
| rs61276843 | |
| pharmgkb | rs61276843 |
| gwascentral | rs61276843 |
| openSNP | rs61276843 |
| 23andMe | rs61276843 |
| SNPshot | rs61276843 |
| SNPdbe | rs61276843 |
| MSV3d | rs61276843 |
| GWAS Ctlg | rs61276843 |
| Status | Deleted |
| Max Magnitude | 0 |
[PMID 23563589] An association study of the Hermansky-Pudlak syndrome type 4 gene in schizophrenic patients
